2(013)

Product Information

M.R.P., A.C.L., L.T.D., P.A.B.M., D.A., D.J.C. and J.A.P. performed experiments. M.R.P., A.C.L. and S.M.P. drafted the manuscript, and all authors reviewed the manuscript. Corresponding authors Saba, J. D. Fifty years of lyase and a moment of truth: Sphingosine phosphate lyase from discovery to disease. J. Lipid. Res. 60, 456–463. https://doi.org/10.1194/jlr.S091181 (2019). To generate doxycycline-inducible S1P 2 shRNA contructs the pTRIPz lentiviral vector was modified with the addition of a poly-linker as described previously 13. shRNA target sequences from Fellmann et al. 42, S1PR2 (5′ TGCTGTTGACAGTGAGCGCAAGGCACTGACTAGTCACATATAGTGAAGCCACAGATGTATATGTGACTAGTCAGTGCCTTATGCCTACTGCCTCGGA) and Renilla luciferase 713 negative control (5′ TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA). shRNA oligonucleotides were amplified using EcoRI MirE primers (5′ TAGAATTCTGCACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG, 3′ TCTCGAATTCTAGCCCCTTGAAGTCCGAG-GCATAGGC). PCR products were digested with EcoRI and cloned into pTRIPZ. To generate lentivirus, HEK293T cells were co-transfected with this vector (or empty pTRIPZ) and pLP1 (gag/pol), pLP2 (rev), pTAT and pVSVG vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two days after transfection the media was changed from DMEM (10% FBS) to RPMI (10% FBS) and incubated for a further two days. The viral supernatant was then added to 5 × 10 6 MV411 cells containing 4 µg/ml polybrene and incubated for an additional 72 h prior to selection with 1 µg/ml of puromycin. Doxycycline induced RFP expression confirmed transduction efficiencies of > 80%. SK1 degradation assays were performed as described previously 47. JTE-013 treatments were compared to DMSO vehicle or SKi positive control in the presence or absence of proteasome inhibitor MG132 (10 µM). Cell survival assays Chen, M. H. et al. Identification of SPHK1 as a therapeutic target and marker of poor prognosis in cholangiocarcinoma. Oncotarget 6, 23594–23608. https://doi.org/10.18632/oncotarget.4335 (2015).

Human S1P lyase cDNA (SGPL1, Genbank Accession number NM_003901) was amplified from placenta cDNA and FLAG epitope-tagged at the 3′ end by PCR with oligonucleotide primers 5′-TATATAGAATTCGCCACCATGCCTAGCACAGACCTTCT-3′ and 5′-TATATAGAATTCACTTGTCATCGTCGTCCTTGTAGTCGTGGGGTTTTGGAGAACCAT-3′. The PCR product was digested with EcoRI and cloned into pcDNA3 (Invitrogen) for expression in mammalian cells. Sequencing verified the orientation and integrity of the cDNA. Quantitative RT-PCR Cirillo, F. et al. The antithetic role of ceramide and sphingosine-1-phosphate in cardiac dysfunction. J. Cell Physiol. 236, 4857–4873. https://doi.org/10.1002/jcp.30235 (2021).Wang, Z. et al. Molecular basis of sphingosine kinase 1 substrate recognition and catalysis. Structure 21, 798–809. https://doi.org/10.1016/j.str.2013.02.025 (2013).

Drexler, Y., Molina, J., Mitrofanova, A., Fornoni, A. & Merscher, S. Sphingosine-1-phosphate metabolism and signaling in kidney diseases. J. Am. Soc. Nephrol. 32, 9–31. https://doi.org/10.1681/ASN.2020050697 (2021). are usually free or discounted: Lawyer Referral & Information Service (LRIS) Committed to Public ServiceSchwab, S. R. et al. Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735–1739. https://doi.org/10.1126/science.1113640 (2005).